Полиморфизм локуса COI митохондриальной ДНК у всеядной листовертки Archips podana в лабораторной культуре

УДК 575.17:595.782

А. Ф. Сафонкин, Т. А. Триселева

Институт проблем экологии и эволюции им. А. Н. Северцова РАН, г. Москва, Россия,
E-mail: tortrix@sevin.ru

Ключевые слова: полиморфизм, митохондриальная ДНК, чешуекрылые

POLYMORPHISM OF MITOCHONDRIAL DNA LOCUS COI
OF APPLE SURFACE-EATING TORTRICID ARCHIPS PODANA
IN LABORATORY CULTURE

A. F. Safonkin, T. A. Triseleva

Severtsov Institute of Ecology and Evolution RAS, Moscow, Russia, E-mail: tortrix@sevin.ru

Key words: polymorphism, mitochondrial DNA, Lepidoptera

Достижения молекулярной биологии открыли широкие возможности получения и анализа генетической информации в исследованиях по эволюции и филогении, изучении популяционной структуры вида и другим направлениям. Для таких исследований часто используют митохондриальную ДНК, которая наследуется по материнской линии.

В качестве модельного объекта выбрана всеядная листовертка Archips podana (Scopoli, 1763). При внешнем мономорфизме вида по особенностям строения полового аппарата выделено 4 морфологические формы самцов («А», «Б», «АБ», «0») и 4 самок («C», «L», «D», «Z») (Сафонкин, Куликов, 2001). Для выяснения механизма наследования указанных морфологических признаков с 1998 г. в лаборатории проводился ряд близкородственных скрещиваний. В одном из них, в 1999 г., при скрещивании самца фенотипа «Б» с самкой, имеющей общего с ним предка, в их потомстве были получены самцы фенотипа «Б», «0», самки фенотипов «С», «L», «D» и гермафродитная куколка. Эксперименты позволили определить, что признак «расположение и количество зубцов на эдеагусе» наследуется по типу моногенного диаллельного расщепления. Ген, контролирующий данный признак, находится в одной из аутосомных групп сцепления. Морфологический тип имаго «0» является крайней невыраженностью фенотипа «Б». Для самок закономерностей в генетическом наследовании фенотипических признаков выявлено не было.

В 2003 г. в третьем поколении лабораторной культуры 20 имаго были взяты для тестирования с целью обнаружения различий по участку генов I субъединицы цитохромоксидазы (COI) митохондриальной ДНК у разных морфологических типов самок. Для исследований использованы общие для рода Archips праймеры CI-J-2183:

 5’ CAACATTTATTTGATTTTTTGG 3’

и CI-N-2659:

5’ GCTAATCCAGTGAATAATGG 3’

(Kruse, Sperling, 2002). Проанализированы нуклеотидные последовательности длиной 490 пн.

В исследованной выборке выявлено две группы листоверток. Для построения дендрограмм использовали компьютерную программу MEGA2. Генетическое разнообразие рассчитывали по методу UPGMA (Unweighted Pair-Group Method with arithmetical Averages). Значение генетических дистанций между группами составляет 0,002, внутри групп не различается. Основное различие исследованных участков цепей митохондриальных ДНК у двух групп листоверток заключается в замене нуклеотида в 291 положении с Т на С. Измененная последовательность принадлежит кластеру, особи которого по материнской линии относятся к потомкам вышеуказанного близкородственного скрещивания, где была получена гермафродитная куколка. В исследованной выборке присутствовала особь четвертого поколения из той же линии. Анализ по методу минимальной эволюции отнес этот образец к той же измененной выборке. Расчет минимальных эволюционных различий по белкам также выявил две группы. В основной группе последовательность 289–291 принадлежит лейцину, измененная – пролину. Различий по исследованным участкам генома у самок разных морфологических типов не обнаружено.

Известно, что изменчивость митохондриальной ДНК в большей мере подвержена случайному дрейфу генов и эффекту «горлышка бутылки» при резком сокращении численности популяции (Алтухов, Салменкова, 2002). Митохондриальная ДНК эволюционирует гораздо быстрее, чем ядерная, и мутации в ней происходят почти в 10 раз чаще. В результате возникает широкий внутривидовой полиморфизм, и ощутимые изменения выявляются в пределах нескольких поколений (Сингер, Берг, 1998). Кроме того, известно, что существует межгенный обмен между органеллами и ядром, а также между геномами самих органелл.

Итак, в результате определенного процесса, возможно связанного с близкородственным скрещиванием в родительском поколении или явлениями, описанными выше, в исследованном участке генома митохондриальной ДНК дочернего поколения произошла устойчивая нуклеотидная замена, передающаяся по наследству. Данная метка может быть использована при изучении механизмов репродуктивного поведения имаго, адаптационных возможностей разных линий всеядной листовертки в лабораторных условиях.

Работа поддержана Программой ОБН РАН «Фундаментальные основы управления биологическими ресурсами», грант 2.3.12.


Zoocenosis — 2005
 Біорізноманіття та роль зооценозу в природних і антропогенних екосистемах: Матеріали ІІІ Міжнародної наукової конференції. – Д.: Вид-во ДНУ, 2005. – С. 301-303.

Розповісти колегам:

Опубликовать в Google Plus
Опубликовать в LiveJournal
Опубликовать в Мой Мир
Опубликовать в Одноклассники